Comparative Transcriptome Analysis Identifying the Different Molecular Genetic Markers Related to Production Performance and Meat Quality in Longissimus Dorsi Tissues of MG × STH and STH Sheep.

Crossbred sheep have many outstanding traits, resembling glorious manufacturing efficiency and high-quality meat, when in comparison with native sheep breeds. However, the genetic molecular markers associated to those traits stay unclear.

The crossbred MG × STH (small-tailed Han sheep (STH) × Mongolian sheep (MG)) breed and the STH breed have been chosen to measure manufacturing efficiency and meat high quality. We used 14 indexes of manufacturing efficiency and meat high quality, which within the MG × STH inhabitants confirmed important variations in comparison with the STH breed.

Subsequently, the longissimusdorsi from the 2 sheep have been subjected to comparative transcriptomic analyses to establish differentially expressed genes (DEGs) associated to manufacturing efficiency and meat high quality. A complete of 874 DEGs have been recognized between the 2 sheep teams.

A complete of 110 distinctive DEGs associated to sheep manufacturing efficiency and meat high quality have been chosen because the candidate DEGs. We discovered 6 production-performance-related and 30 meat-quality-related DEGs by means of a correlation evaluation, together with SPARCACVRL1FNDC5 and FREM1.

The expression ranges of 11 DEGs have been validated by real-time PCR, and the outcomes have been in accordance with the outcomes of the comparative transcriptomic and correlation analyses. These outcomes will help in understanding sheep heterosis and molecular marker-assisted choice.

Use of molecular markers can help to understand the genetic diversity of Babesia bovis.

Cattle babesiosis is a tick-borne illness chargeable for important losses for the livestock industries in tropical areas of the world. These piroplasms are underneath fixed management of the host immune system, which result in a powerful selective stress for arising extra virulent or attenuated phenotypes.

EEF1A1 siRNA

20-abx901642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 siRNA

20-abx914974
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 siRNA

20-abx914975
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

eEF1A1 Antibody

49856-100ul 100ul
EUR 333.00

eEF1A1 Antibody

49856-50ul 50ul
EUR 239.00

EEF1A1 Antibody

ABD6156 100 ug
EUR 438.00

EEF1A1 Antibody

32103-100ul 100ul
EUR 252.00

EEF1A1 antibody

70R-1029 100 ug
EUR 377.00
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1

EEF1A1 antibody

70R-17000 50 ul
EUR 435.00
Description: Rabbit polyclonal EEF1A1 antibody

EEF1A1 Antibody

1-CSB-PA007409GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF1A1 Antibody

1-CSB-PA007409LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-eEF1A1

YF-PA23621 50 ul
EUR 334.00
Description: Mouse polyclonal to eEF1A1

EEF1A1 Antibody

DF6156 200ul
EUR 304.00
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1.

eEF1A1 Conjugated Antibody

C49856 100ul
EUR 397.00

EEF1A1 Conjugated Antibody

C32103 100ul
EUR 397.00

EEF1A1 Blocking Peptide

33R-4196 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A1 antibody, catalog no. 70R-1029

EEF1A1 cloning plasmid

CSB-CL007409HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg
  • Show more
Description: A cloning plasmid for the EEF1A1 gene.

pCMV-SPORT6-EEF1A1

PVT13636 2 ug
EUR 391.00

Anti-EEF1A1 antibody

PAab02641 100 ug
EUR 386.00

EEF1A1 Rabbit pAb

A17857-100ul 100 ul
EUR 308.00

EEF1A1 Rabbit pAb

A17857-200ul 200 ul
EUR 459.00

EEF1A1 Rabbit pAb

A17857-20ul 20 ul
EUR 183.00

EEF1A1 Rabbit pAb

A17857-50ul 50 ul
EUR 223.00

EEF1A1 Blocking Peptide

DF6156-BP 1mg
EUR 195.00

EEF1A1 Rabbit pAb

A0831-100ul 100 ul
EUR 308.00

EEF1A1 Rabbit pAb

A0831-200ul 200 ul
EUR 459.00

EEF1A1 Rabbit pAb

A0831-20ul 20 ul Ask for price

EEF1A1 Rabbit pAb

A0831-50ul 50 ul Ask for price

eEF1A1 Rabbit mAb

A11545-100ul 100 ul
EUR 410.00

eEF1A1 Rabbit mAb

A11545-200ul 200 ul
EUR 571.00

eEF1A1 Rabbit mAb

A11545-20ul 20 ul
EUR 221.00

eEF1A1 Rabbit mAb

A11545-50ul 50 ul
EUR 287.00

EEF1A1 Rabbit pAb

A0974-100ul 100 ul
EUR 308.00

EEF1A1 Rabbit pAb

A0974-200ul 200 ul
EUR 459.00

EEF1A1 Rabbit pAb

A0974-20ul 20 ul
EUR 183.00

EEF1A1 Rabbit pAb

A0974-50ul 50 ul
EUR 223.00

anti- EEF1A1 antibody

FNab02641 100µg
EUR 548.75
  • Immunogen: eukaryotic translation elongation factor 1 alpha 1
  • Uniprot ID: P68104
  • Gene ID: 1915
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF1A1

Human EEF1A1 Antibody

35679-05111 150 ug
EUR 261.00

Anti-EEF1A1 antibody

STJ111034 100 µl
EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ119870 100 µl
EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ23475 100 µl
EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Human EEF1A1 shRNA Plasmid

20-abx951332
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

eEF1A1 recombinant monoclonal antibody

A5854 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human eEF1A1 for WB, IHC,ELISA

EEF1A1 protein (His tag)

80R-3746 100 ug
EUR 349.00
Description: Purified recombinant EEF1A1 protein (His tag)

EEF1A1/2 Polyclonal Antibody

E-AB-30239-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1/2 Polyclonal Antibody

E-AB-30239-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1/2 Polyclonal Antibody

E-AB-30239-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1 ELISA KIT|Human

EF003718 96 Tests
EUR 689.00

Human EEF1A1 ELISA Kit

ELA-E11476h 96 Tests
EUR 824.00

Acetyl-EEF1A1 (K41) Antibody

1-CSB-PA000115
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-EEF1A1 (K41). Recognizes Acetyl-EEF1A1 (K41) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Mouse EEF1A1 shRNA Plasmid

20-abx970113
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EEF1A1 shRNA Plasmid

20-abx987742
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1A1 / EEF1A2 / EEF1A1P5 Antibody

20-abx327705
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EEF1A1/EEF1A2/EEF1A1P5 Antibody

1-CSB-PA005918
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1 Antibody, HRP conjugated

1-CSB-PA007409LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, FITC conjugated

1-CSB-PA007409LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, Biotin conjugated

1-CSB-PA007409LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EEF1A1 Recombinant Protein (Human)

RP010192 100 ug Ask for price

EEF1A1 Recombinant Protein (Mouse)

RP130895 100 ug Ask for price

EEF1A1 Recombinant Protein (Rat)

RP199079 100 ug Ask for price

EEF1A1 ORF Vector (Human) (pORF)

ORF003398 1.0 ug DNA
EUR 95.00

Eef1a1 ORF Vector (Rat) (pORF)

ORF066361 1.0 ug DNA
EUR 506.00

Eef1a1 ORF Vector (Mouse) (pORF)

ORF043633 1.0 ug DNA
EUR 506.00

Human EEF1A1 Antibody (Biotin Conjugate)

35679-05121 150 ug
EUR 369.00

Polyclonal EEF1A1 Antibody (N-term)

APR05771G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal EEF1A1 Antibody (C-term)

APR05772G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (C-term). This antibody is tested and proven to work in the following applications:

EEF1A1 sgRNA CRISPR Lentivector set (Human)

K0654801 3 x 1.0 ug
EUR 339.00

Eef1a1 sgRNA CRISPR Lentivector set (Mouse)

K3976801 3 x 1.0 ug
EUR 339.00

Eef1a1 sgRNA CRISPR Lentivector set (Rat)

K7550701 3 x 1.0 ug
EUR 339.00

Human EEF1A1 AssayLite Antibody (FITC Conjugate)

35679-05141 150 ug
EUR 428.00

Human EEF1A1 AssayLite Antibody (RPE Conjugate)

35679-05151 150 ug
EUR 428.00

Human EEF1A1 AssayLite Antibody (APC Conjugate)

35679-05161 150 ug
EUR 428.00

Human EEF1A1 AssayLite Antibody (PerCP Conjugate)

35679-05171 150 ug
EUR 471.00

Human Elongation factor 1-alpha 1 (EEF1A1)

1-CSB-EP007409HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

Human Elongation factor 1-alpha 1 (EEF1A1)

1-CSB-EP007409HUa0
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

Human Elongation factor 1-alpha 1 (EEF1A1)

1-CSB-EP007409HUe1
  • EUR 496.00
  • EUR 330.00
  • EUR 1425.00
  • EUR 677.00
  • EUR 989.00
  • EUR 378.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0654802 1.0 ug DNA
EUR 154.00

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0654803 1.0 ug DNA
EUR 154.00

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0654804 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3976802 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3976803 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3976804 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7550702 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7550703 1.0 ug DNA
EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7550704 1.0 ug DNA
EUR 154.00

EEF1A1 Protein Vector (Rat) (pPB-C-His)

PV265442 500 ng
EUR 603.00

EEF1A1 Protein Vector (Rat) (pPB-N-His)

PV265443 500 ng
EUR 603.00

EEF1A1 Protein Vector (Rat) (pPM-C-HA)

PV265444 500 ng
EUR 603.00

EEF1A1 Protein Vector (Rat) (pPM-C-His)

PV265445 500 ng
EUR 603.00

EEF1A1 3'UTR Luciferase Stable Cell Line

TU006573 1.0 ml
EUR 1521.00

EEF1A1 3'UTR GFP Stable Cell Line

TU056573 1.0 ml
EUR 1521.00

EEF1A1 Protein Vector (Mouse) (pPB-C-His)

PV174530 500 ng
EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPB-N-His)

PV174531 500 ng
EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPM-C-HA)

PV174532 500 ng
EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPM-C-His)

PV174533 500 ng
EUR 603.00

Eef1a1 3'UTR GFP Stable Cell Line

TU155609 1.0 ml Ask for price

Eef1a1 3'UTR GFP Stable Cell Line

TU253787 1.0 ml Ask for price

Eef1a1 3'UTR Luciferase Stable Cell Line

TU203787 1.0 ml Ask for price

Eef1a1 3'UTR Luciferase Stable Cell Line

TU105609 1.0 ml Ask for price

EEF1A1 Protein Vector (Human) (pPB-C-His)

PV013589 500 ng
EUR 329.00

EEF1A1 Protein Vector (Human) (pPB-N-His)

PV013590 500 ng
EUR 329.00

EEF1A1 Protein Vector (Human) (pPM-C-HA)

PV013591 500 ng
EUR 329.00

EEF1A1 Protein Vector (Human) (pPM-C-His)

PV013592 500 ng
EUR 329.00

EEF1A1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673339 1.0 ug DNA
EUR 682.00

EEF1A1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673343 1.0 ug DNA
EUR 682.00

EEF1A1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673344 1.0 ug DNA
EUR 682.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx232641-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx032889-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx032889-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx032890-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx032890-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx312697
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx000927
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bovine Elongation factor 1- alpha 1, EEF1A1 ELISA KIT

ELI-47134b 96 Tests
EUR 928.00

Mouse Elongation factor 1- alpha 1, Eef1a1 ELISA KIT

ELI-09608m 96 Tests
EUR 865.00

Human Elongation factor 1- alpha 1, EEF1A1 ELISA KIT

ELI-08681h 96 Tests
EUR 824.00

Rabbit Elongation factor 1- alpha 1, EEF1A1 ELISA KIT

ELI-08682Ra 96 Tests
EUR 928.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody

20-abx172297
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit

abx250573-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx327486
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cow Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit

abx515460-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit

abx515462-96tests 96 tests
EUR 739.00
  • Shipped within 5-12 working days.

Rat Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit

abx515463-96tests 96 tests
EUR 739.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx126891
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

abx145202-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx141573
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody

20-abx130797
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody

20-abx112349
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit

20-abx156817
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Recombinant Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1)

4-RPF020Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P68104
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Alpha 1 expressed in: E.coli

Rat Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit

E0318Ra 1 Kit
EUR 646.00

Human EEF1A1/ Elongation factor 1-alpha 1 ELISA Kit

E0762Hu 1 Kit
EUR 605.00

Mouse Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit

E0449Mo 1 Kit
EUR 632.00

Human EEF1A1(Elongation factor 1-alpha 1) ELISA Kit

EH1308 96T
EUR 567.60
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P68104
  • Alias: EEF1A1(Elongation factor 1-alpha 1)/EEF1A/EF1A/LENG7/EF-1-alpha-1/EF-Tu/eEF1A-1/Leukocyte receptor cluster member 7/Elongation factor Tu/Eukaryotic elongation factor 1 A-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human EEF1A1 AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)

35679-05181 1 x 75 ug, 3 x 30 ug
EUR 585.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (HRP)

20-abx312698
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (FITC)

20-abx312699
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (Biotin)

20-abx312700
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Protein

20-abx650631
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0654805 3 x 1.0 ug
EUR 376.00

Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3976805 3 x 1.0 ug
EUR 376.00

Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7550705 3 x 1.0 ug
EUR 376.00

EEF1A1 ELISA Kit| Bovine Elongation factor 1-alpha 1 ELISA Kit

EF011364 96 Tests
EUR 689.00

Eef1a1 ELISA Kit| Rat Elongation factor 1-alpha 1 ELISA Kit

EF018653 96 Tests
EUR 689.00

Eef1a1 ELISA Kit| Mouse Elongation factor 1-alpha 1 ELISA Kit

EF014837 96 Tests
EUR 689.00

Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) CLIA Kit

20-abx494790
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0654806 1.0 ug DNA
EUR 167.00

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0654807 1.0 ug DNA
EUR 167.00

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0654808 1.0 ug DNA
EUR 167.00

Aiming to higher perceive essentially the most essential genetic modifications in Babesia bovis genome, associated to virulence, an in silico evaluation was carried out utilizing DNA sequences from GenBank. Fourteen genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80 (or Bb-1), 18S rRNA, acs-1, ama-1, β-tub, cp-2, p0, rap-1a) associated to parasite an infection and immunogenicity and ITS area have been chosen for alignment and comparability of a number of isolates of Babesia bovis from completely different geographic areas all over the world.

Among the 15 genes chosen for the examine of variety, solely 7 genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80) and the ITS area introduced ample genetic variation for the research of phylogeny. Despite this genetic variety noticed into teams, there was not ample info obtainable to affiliate molecular markers with virulence of isolates. However, some genetic teams no have been correlated with geographic area what might point out some typical evolutionary traits within the relation between parasite-host.

Further research utilizing these genes in herds presenting numerous scientific circumstances are required. The higher understanding of evolutionary mechanisms of the parasite might contribute to enhance prophylactic and therapeutic measures. In this fashion, we recommend that genes utilized in our examine are potential markers of virulence and attenuation and need to be analyzed with using sequences from animals that current scientific indicators of babesiosis and asymptomatic carriers.