Crossbred sheep have many outstanding traits, resembling glorious manufacturing efficiency and high-quality meat, when in comparison with native sheep breeds. However, the genetic molecular markers associated to those traits stay unclear.
The crossbred MG × STH (small-tailed Han sheep (STH) × Mongolian sheep (MG)) breed and the STH breed have been chosen to measure manufacturing efficiency and meat high quality. We used 14 indexes of manufacturing efficiency and meat high quality, which within the MG × STH inhabitants confirmed important variations in comparison with the STH breed.
Subsequently, the longissimusdorsi from the 2 sheep have been subjected to comparative transcriptomic analyses to establish differentially expressed genes (DEGs) associated to manufacturing efficiency and meat high quality. A complete of 874 DEGs have been recognized between the 2 sheep teams.
A complete of 110 distinctive DEGs associated to sheep manufacturing efficiency and meat high quality have been chosen because the candidate DEGs. We discovered 6 production-performance-related and 30 meat-quality-related DEGs by means of a correlation evaluation, together with SPARC, ACVRL1, FNDC5 and FREM1.
The expression ranges of 11 DEGs have been validated by real-time PCR, and the outcomes have been in accordance with the outcomes of the comparative transcriptomic and correlation analyses. These outcomes will help in understanding sheep heterosis and molecular marker-assisted choice.
Use of molecular markers can help to understand the genetic diversity of Babesia bovis.
Cattle babesiosis is a tick-borne illness chargeable for important losses for the livestock industries in tropical areas of the world. These piroplasms are underneath fixed management of the host immune system, which result in a powerful selective stress for arising extra virulent or attenuated phenotypes.
EEF1A1 antibody |
70R-17000 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EEF1A1 antibody |
EEF1A1 antibody |
70R-1029 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1 |
EEF1A1 Antibody |
32103-100ul |
SAB |
100ul |
EUR 252 |
eEF1A1 Antibody |
49856-100ul |
SAB |
100ul |
EUR 333 |
eEF1A1 Antibody |
49856-50ul |
SAB |
50ul |
EUR 239 |
EEF1A1 Antibody |
DF6156 |
Affbiotech |
200ul |
EUR 304 |
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1. |
EEF1A1 Antibody |
1-CSB-PA007409GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EEF1A1 Antibody |
1-CSB-PA007409LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
EEF1A1 siRNA |
20-abx901642 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF1A1 siRNA |
20-abx914974 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF1A1 siRNA |
20-abx914975 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-eEF1A1 |
YF-PA23621 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to eEF1A1 |
EEF1A1 Rabbit pAb |
A0831-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF1A1 Rabbit pAb |
A0831-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF1A1 Rabbit pAb |
A0831-20ul |
Abclonal |
20 ul |
Ask for price |
EEF1A1 Rabbit pAb |
A0831-50ul |
Abclonal |
50 ul |
Ask for price |
EEF1A1 Rabbit pAb |
A0974-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF1A1 Rabbit pAb |
A0974-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF1A1 Rabbit pAb |
A0974-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF1A1 Rabbit pAb |
A0974-50ul |
Abclonal |
50 ul |
EUR 223 |
eEF1A1 Rabbit mAb |
A11545-100ul |
Abclonal |
100 ul |
EUR 410 |
eEF1A1 Rabbit mAb |
A11545-200ul |
Abclonal |
200 ul |
EUR 571 |
eEF1A1 Rabbit mAb |
A11545-20ul |
Abclonal |
20 ul |
EUR 221 |
eEF1A1 Rabbit mAb |
A11545-50ul |
Abclonal |
50 ul |
EUR 287 |
EEF1A1 Blocking Peptide |
33R-4196 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A1 antibody, catalog no. 70R-1029 |
Human EEF1A1 Antibody |
35679-05111 |
AssayPro |
150 ug |
EUR 261 |
EEF1A1 Blocking Peptide |
DF6156-BP |
Affbiotech |
1mg |
EUR 195 |
eEF1A1 Conjugated Antibody |
C49856 |
SAB |
100ul |
EUR 397 |
EEF1A1 Conjugated Antibody |
C32103 |
SAB |
100ul |
EUR 397 |
EEF1A1 cloning plasmid |
CSB-CL007409HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1389
- Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg
- Show more
|
Description: A cloning plasmid for the EEF1A1 gene. |
EEF1A1 Rabbit pAb |
A17857-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF1A1 Rabbit pAb |
A17857-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF1A1 Rabbit pAb |
A17857-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF1A1 Rabbit pAb |
A17857-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- EEF1A1 antibody |
FNab02641 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: eukaryotic translation elongation factor 1 alpha 1
- Uniprot ID: P68104
- Gene ID: 1915
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against EEF1A1 |
Anti-EEF1A1 antibody |
STJ111034 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. |
Anti-EEF1A1 antibody |
STJ119870 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. |
Anti-EEF1A1 antibody |
STJ23475 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. |
EEF1A1/EEF1A2/EEF1A1P5 Antibody |
1-CSB-PA005918 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
Acetyl-EEF1A1 (K41) Antibody |
1-CSB-PA000115 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Acetyl-EEF1A1 (K41). Recognizes Acetyl-EEF1A1 (K41) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
EEF1A1 protein (His tag) |
80R-3746 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Purified recombinant EEF1A1 protein (His tag) |
Rat EEF1A1 shRNA Plasmid |
20-abx987742 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EEF1A1 Antibody, HRP conjugated |
1-CSB-PA007409LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EEF1A1 Antibody, FITC conjugated |
1-CSB-PA007409LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EEF1A1 Antibody, Biotin conjugated |
1-CSB-PA007409LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EEF1A1 / EEF1A2 / EEF1A1P5 Antibody |
20-abx327705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse EEF1A1 shRNA Plasmid |
20-abx970113 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EEF1A1 shRNA Plasmid |
20-abx951332 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
eEF1A1 recombinant monoclonal antibody |
A5854 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human eEF1A1 for WB, IHC,ELISA |
EEF1A1 Recombinant Protein (Human) |
RP010192 |
ABM |
100 ug |
Ask for price |
EEF1A1 Recombinant Protein (Rat) |
RP199079 |
ABM |
100 ug |
Ask for price |
EEF1A1 Recombinant Protein (Mouse) |
RP130895 |
ABM |
100 ug |
Ask for price |
Human EEF1A1 Antibody (Biotin Conjugate) |
35679-05121 |
AssayPro |
150 ug |
EUR 369 |
Polyclonal EEF1A1 Antibody (N-term) |
APR05771G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal EEF1A1 Antibody (C-term) |
APR05772G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (C-term). This antibody is tested and proven to work in the following applications: |
Eef1a1 ORF Vector (Rat) (pORF) |
ORF066361 |
ABM |
1.0 ug DNA |
EUR 506 |
EEF1A1 ORF Vector (Human) (pORF) |
ORF003398 |
ABM |
1.0 ug DNA |
EUR 95 |
Eef1a1 ORF Vector (Mouse) (pORF) |
ORF043633 |
ABM |
1.0 ug DNA |
EUR 506 |
EEF1A1 ELISA Kit (Human) (OKCD08740) |
OKCD08740 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: EEF1A1 is an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome.This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
EEF1A1 ELISA Kit (Mouse) (OKEH05651) |
OKEH05651 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis. With PARP1 and TXK, forms a complex that acts as a T helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFN-gamma to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL |
EEF1A1 ELISA Kit (Bovine) (OKEH07735) |
OKEH07735 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Human EEF1A1 AssayLite Antibody (FITC Conjugate) |
35679-05141 |
AssayPro |
150 ug |
EUR 428 |
Human EEF1A1 AssayLite Antibody (RPE Conjugate) |
35679-05151 |
AssayPro |
150 ug |
EUR 428 |
Human EEF1A1 AssayLite Antibody (APC Conjugate) |
35679-05161 |
AssayPro |
150 ug |
EUR 428 |
Human EEF1A1 AssayLite Antibody (PerCP Conjugate) |
35679-05171 |
AssayPro |
150 ug |
EUR 471 |
EEF1A1 sgRNA CRISPR Lentivector set (Human) |
K0654801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eef1a1 sgRNA CRISPR Lentivector set (Rat) |
K7550701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eef1a1 sgRNA CRISPR Lentivector set (Mouse) |
K3976801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Elongation factor 1-alpha 1 (EEF1A1) |
1-CSB-EP007409HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli |
Human Elongation factor 1-alpha 1 (EEF1A1) |
1-CSB-EP007409HUa0 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli |
Human Elongation factor 1-alpha 1 (EEF1A1) |
1-CSB-EP007409HUe1 |
Cusabio |
-
EUR 496.00
-
EUR 330.00
-
EUR 1425.00
-
EUR 677.00
-
EUR 989.00
-
EUR 378.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli |
EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0654802 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0654803 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0654804 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7550702 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7550703 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7550704 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3976802 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3976803 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3976804 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF1A1 Protein Vector (Mouse) (pPB-C-His) |
PV174530 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Mouse) (pPB-N-His) |
PV174531 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Mouse) (pPM-C-HA) |
PV174532 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Mouse) (pPM-C-His) |
PV174533 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Rat) (pPB-C-His) |
PV265442 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Rat) (pPB-N-His) |
PV265443 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Rat) (pPM-C-HA) |
PV265444 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Rat) (pPM-C-His) |
PV265445 |
ABM |
500 ng |
EUR 603 |
EEF1A1 Protein Vector (Human) (pPB-C-His) |
PV013589 |
ABM |
500 ng |
EUR 329 |
EEF1A1 Protein Vector (Human) (pPB-N-His) |
PV013590 |
ABM |
500 ng |
EUR 329 |
EEF1A1 Protein Vector (Human) (pPM-C-HA) |
PV013591 |
ABM |
500 ng |
EUR 329 |
EEF1A1 Protein Vector (Human) (pPM-C-His) |
PV013592 |
ABM |
500 ng |
EUR 329 |
Eef1a1 3'UTR GFP Stable Cell Line |
TU155609 |
ABM |
1.0 ml |
Ask for price |
Eef1a1 3'UTR Luciferase Stable Cell Line |
TU105609 |
ABM |
1.0 ml |
Ask for price |
Eef1a1 3'UTR Luciferase Stable Cell Line |
TU203787 |
ABM |
1.0 ml |
Ask for price |
Eef1a1 3'UTR GFP Stable Cell Line |
TU253787 |
ABM |
1.0 ml |
Ask for price |
EEF1A1 3'UTR GFP Stable Cell Line |
TU056573 |
ABM |
1.0 ml |
EUR 1521 |
EEF1A1 3'UTR Luciferase Stable Cell Line |
TU006573 |
ABM |
1.0 ml |
EUR 1521 |
EEF1A1 ELISA Kit (Human) : 96 Wells (OKEH02166) |
OKEH02166 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.069 ng/mL |
EEF1A1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV673339 |
ABM |
1.0 ug DNA |
EUR 682 |
EEF1A1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV673343 |
ABM |
1.0 ug DNA |
EUR 682 |
EEF1A1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV673344 |
ABM |
1.0 ug DNA |
EUR 682 |
Human EEF1A1 AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate) |
35679-05181 |
AssayPro |
1 x 75 ug, 3 x 30 ug |
EUR 585 |
Rat Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit |
E0318Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit |
E0449Mo |
Sunlong |
1 Kit |
EUR 632 |
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx112349 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx126891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody |
20-abx130797 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx145202-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit |
20-abx156817 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx141573 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody |
20-abx172297 |
Abbexa |
|
|
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx032889-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx032889-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx032890-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx032890-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit |
abx250573-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human EEF1A1/ Elongation factor 1-alpha 1 ELISA Kit |
E0762Hu |
Sunlong |
1 Kit |
EUR 605 |
Human EEF1A1(Elongation factor 1-alpha 1) ELISA Kit |
EH1308 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P68104
- Alias: EEF1A1(Elongation factor 1-alpha 1)/EEF1A/EF1A/LENG7/EF-1-alpha-1/EF-Tu/eEF1A-1/Leukocyte receptor cluster member 7/Elongation factor Tu/Eukaryotic elongation factor 1 A-1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Elongation factor 1- alpha 1, EEF1A1 ELISA KIT |
ELI-08681h |
Lifescience Market |
96 Tests |
EUR 824 |
Rabbit Elongation factor 1- alpha 1, EEF1A1 ELISA KIT |
ELI-08682Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Elongation factor 1- alpha 1, Eef1a1 ELISA KIT |
ELI-09608m |
Lifescience Market |
96 Tests |
EUR 865 |
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx327486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cow Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit |
abx515460-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit |
abx515462-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit |
abx515463-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx312697 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
abx232641-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody |
20-abx000927 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Bovine Elongation factor 1- alpha 1, EEF1A1 ELISA KIT |
ELI-47134b |
Lifescience Market |
96 Tests |
EUR 928 |
Recombinant Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) |
4-RPF020Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P68104
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Alpha 1 expressed in: E.coli |
Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Protein |
20-abx650631 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (HRP) |
20-abx312698 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (FITC) |
20-abx312699 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (Biotin) |
20-abx312700 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0654805 |
ABM |
3 x 1.0 ug |
EUR 376 |
Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K7550705 |
ABM |
3 x 1.0 ug |
EUR 376 |
Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3976805 |
ABM |
3 x 1.0 ug |
EUR 376 |
Eef1a1 ELISA Kit| Rat Elongation factor 1-alpha 1 ELISA Kit |
EF018653 |
Lifescience Market |
96 Tests |
EUR 689 |
Eef1a1 ELISA Kit| Mouse Elongation factor 1-alpha 1 ELISA Kit |
EF014837 |
Lifescience Market |
96 Tests |
EUR 689 |
EEF1A1 ELISA Kit| Bovine Elongation factor 1-alpha 1 ELISA Kit |
EF011364 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) CLIA Kit |
20-abx494790 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0654806 |
ABM |
1.0 ug DNA |
EUR 167 |
EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0654807 |
ABM |
1.0 ug DNA |
EUR 167 |
Aiming to higher perceive essentially the most essential genetic modifications in Babesia bovis genome, associated to virulence, an in silico evaluation was carried out utilizing DNA sequences from GenBank. Fourteen genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80 (or Bb-1), 18S rRNA, acs-1, ama-1, β-tub, cp-2, p0, rap-1a) associated to parasite an infection and immunogenicity and ITS area have been chosen for alignment and comparability of a number of isolates of Babesia bovis from completely different geographic areas all over the world.
Among the 15 genes chosen for the examine of variety, solely 7 genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80) and the ITS area introduced ample genetic variation for the research of phylogeny. Despite this genetic variety noticed into teams, there was not ample info obtainable to affiliate molecular markers with virulence of isolates. However, some genetic teams no have been correlated with geographic area what might point out some typical evolutionary traits within the relation between parasite-host.
Further research utilizing these genes in herds presenting numerous scientific circumstances are required. The higher understanding of evolutionary mechanisms of the parasite might contribute to enhance prophylactic and therapeutic measures. In this fashion, we recommend that genes utilized in our examine are potential markers of virulence and attenuation and need to be analyzed with using sequences from animals that current scientific indicators of babesiosis and asymptomatic carriers.