Comparative Transcriptome Analysis Identifying the Different Molecular Genetic Markers Related to Production Performance and Meat Quality in Longissimus Dorsi Tissues of MG × STH and STH Sheep.

Crossbred sheep have many outstanding traits, resembling glorious manufacturing efficiency and high-quality meat, when in comparison with native sheep breeds. However, the genetic molecular markers associated to those traits stay unclear.

The crossbred MG × STH (small-tailed Han sheep (STH) × Mongolian sheep (MG)) breed and the STH breed have been chosen to measure manufacturing efficiency and meat high quality. We used 14 indexes of manufacturing efficiency and meat high quality, which within the MG × STH inhabitants confirmed important variations in comparison with the STH breed.

Subsequently, the longissimusdorsi from the 2 sheep have been subjected to comparative transcriptomic analyses to establish differentially expressed genes (DEGs) associated to manufacturing efficiency and meat high quality. A complete of 874 DEGs have been recognized between the 2 sheep teams.

A complete of 110 distinctive DEGs associated to sheep manufacturing efficiency and meat high quality have been chosen because the candidate DEGs. We discovered 6 production-performance-related and 30 meat-quality-related DEGs by means of a correlation evaluation, together with SPARC, ACVRL1, FNDC5 and FREM1.

The expression ranges of 11 DEGs have been validated by real-time PCR, and the outcomes have been in accordance with the outcomes of the comparative transcriptomic and correlation analyses. These outcomes will help in understanding sheep heterosis and molecular marker-assisted choice.

Use of molecular markers can help to understand the genetic diversity of Babesia bovis.

Cattle babesiosis is a tick-borne illness chargeable for important losses for the livestock industries in tropical areas of the world. These piroplasms are underneath fixed management of the host immune system, which result in a powerful selective stress for arising extra virulent or attenuated phenotypes.

EEF1A1 siRNA
20-abx901642	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF1A1 siRNA
20-abx914974	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EEF1A1 siRNA
20-abx914975	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

eEF1A1 Antibody
49856-100ul	SAB	100ul	EUR 333.00

eEF1A1 Antibody
49856-50ul	SAB	50ul	EUR 239.00

EEF1A1 Antibody
ABD6156	Lifescience Market	100 ug	EUR 438.00

EEF1A1 Antibody
32103-100ul	SAB	100ul	EUR 252.00

EEF1A1 antibody
70R-1029	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1

EEF1A1 antibody
70R-17000	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal EEF1A1 antibody

EEF1A1 Antibody
1-CSB-PA007409GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF1A1 Antibody
1-CSB-PA007409LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-eEF1A1
YF-PA23621	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to eEF1A1

EEF1A1 Antibody
DF6156	Affbiotech	200ul	EUR 304.00
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1.

eEF1A1 Conjugated Antibody
C49856	SAB	100ul	EUR 397.00

EEF1A1 Conjugated Antibody
C32103	SAB	100ul	EUR 397.00

EEF1A1 Blocking Peptide
33R-4196	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A1 antibody, catalog no. 70R-1029

EEF1A1 cloning plasmid
CSB-CL007409HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1389 Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg Show more
Description: A cloning plasmid for the EEF1A1 gene.

pCMV-SPORT6-EEF1A1
PVT13636	Lifescience Market	2 ug	EUR 391.00

Anti-EEF1A1 antibody
PAab02641	Lifescience Market	100 ug	EUR 386.00

EEF1A1 Rabbit pAb
A17857-100ul	Abclonal	100 ul	EUR 308.00

EEF1A1 Rabbit pAb
A17857-200ul	Abclonal	200 ul	EUR 459.00

EEF1A1 Rabbit pAb
A17857-20ul	Abclonal	20 ul	EUR 183.00

EEF1A1 Rabbit pAb
A17857-50ul	Abclonal	50 ul	EUR 223.00

EEF1A1 Blocking Peptide
DF6156-BP	Affbiotech	1mg	EUR 195.00

EEF1A1 Rabbit pAb
A0831-100ul	Abclonal	100 ul	EUR 308.00

EEF1A1 Rabbit pAb
A0831-200ul	Abclonal	200 ul	EUR 459.00

EEF1A1 Rabbit pAb
A0831-20ul	Abclonal	20 ul	Ask for price

EEF1A1 Rabbit pAb
A0831-50ul	Abclonal	50 ul	Ask for price

eEF1A1 Rabbit mAb
A11545-100ul	Abclonal	100 ul	EUR 410.00

eEF1A1 Rabbit mAb
A11545-200ul	Abclonal	200 ul	EUR 571.00

eEF1A1 Rabbit mAb
A11545-20ul	Abclonal	20 ul	EUR 221.00

eEF1A1 Rabbit mAb
A11545-50ul	Abclonal	50 ul	EUR 287.00

EEF1A1 Rabbit pAb
A0974-100ul	Abclonal	100 ul	EUR 308.00

EEF1A1 Rabbit pAb
A0974-200ul	Abclonal	200 ul	EUR 459.00

EEF1A1 Rabbit pAb
A0974-20ul	Abclonal	20 ul	EUR 183.00

EEF1A1 Rabbit pAb
A0974-50ul	Abclonal	50 ul	EUR 223.00

anti- EEF1A1 antibody
FNab02641	FN Test	100µg	EUR 548.75
Immunogen: eukaryotic translation elongation factor 1 alpha 1 Uniprot ID: P68104 Gene ID: 1915 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF1A1

Human EEF1A1 Antibody
35679-05111	AssayPro	150 ug	EUR 261.00

Anti-EEF1A1 antibody
STJ111034	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody
STJ119870	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody
STJ23475	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Human EEF1A1 shRNA Plasmid
20-abx951332	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

eEF1A1 recombinant monoclonal antibody
A5854	Bimake	100ul X 3	EUR 595.00
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human eEF1A1 for WB, IHC,ELISA

EEF1A1 protein (His tag)
80R-3746	Fitzgerald	100 ug	EUR 349.00
Description: Purified recombinant EEF1A1 protein (His tag)

EEF1A1/2 Polyclonal Antibody
E-AB-30239-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1/2 Polyclonal Antibody
E-AB-30239-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1/2 Polyclonal Antibody
E-AB-30239-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes Show more
Description: Rabbit antibody against Human,Mouse,Rat EEF1A1/2 for WB,ELISA applications.

EEF1A1 ELISA KIT|Human
EF003718	Lifescience Market	96 Tests	EUR 689.00

Human EEF1A1 ELISA Kit
ELA-E11476h	Lifescience Market	96 Tests	EUR 824.00

Acetyl-EEF1A1 (K41) Antibody
1-CSB-PA000115	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-EEF1A1 (K41). Recognizes Acetyl-EEF1A1 (K41) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Mouse EEF1A1 shRNA Plasmid
20-abx970113	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat EEF1A1 shRNA Plasmid
20-abx987742	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF1A1 / EEF1A2 / EEF1A1P5 Antibody
20-abx327705	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

EEF1A1/EEF1A2/EEF1A1P5 Antibody
1-CSB-PA005918	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1 Antibody, HRP conjugated
1-CSB-PA007409LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, FITC conjugated
1-CSB-PA007409LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, Biotin conjugated
1-CSB-PA007409LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EEF1A1 Recombinant Protein (Human)
RP010192	ABM	100 ug	Ask for price

EEF1A1 Recombinant Protein (Mouse)
RP130895	ABM	100 ug	Ask for price

EEF1A1 Recombinant Protein (Rat)
RP199079	ABM	100 ug	Ask for price

EEF1A1 ORF Vector (Human) (pORF)
ORF003398	ABM	1.0 ug DNA	EUR 95.00

Eef1a1 ORF Vector (Rat) (pORF)
ORF066361	ABM	1.0 ug DNA	EUR 506.00

Eef1a1 ORF Vector (Mouse) (pORF)
ORF043633	ABM	1.0 ug DNA	EUR 506.00

Human EEF1A1 Antibody (Biotin Conjugate)
35679-05121	AssayPro	150 ug	EUR 369.00

Polyclonal EEF1A1 Antibody (N-term)
APR05771G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal EEF1A1 Antibody (C-term)
APR05772G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (C-term). This antibody is tested and proven to work in the following applications:

EEF1A1 sgRNA CRISPR Lentivector set (Human)
K0654801	ABM	3 x 1.0 ug	EUR 339.00

Eef1a1 sgRNA CRISPR Lentivector set (Mouse)
K3976801	ABM	3 x 1.0 ug	EUR 339.00

Eef1a1 sgRNA CRISPR Lentivector set (Rat)
K7550701	ABM	3 x 1.0 ug	EUR 339.00

Human EEF1A1 AssayLite Antibody (FITC Conjugate)
35679-05141	AssayPro	150 ug	EUR 428.00

Human EEF1A1 AssayLite Antibody (RPE Conjugate)
35679-05151	AssayPro	150 ug	EUR 428.00

Human EEF1A1 AssayLite Antibody (APC Conjugate)
35679-05161	AssayPro	150 ug	EUR 428.00

Human EEF1A1 AssayLite Antibody (PerCP Conjugate)
35679-05171	AssayPro	150 ug	EUR 471.00

Human Elongation factor 1-alpha 1 (EEF1A1)
1-CSB-EP007409HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 66.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

Human Elongation factor 1-alpha 1 (EEF1A1)
1-CSB-EP007409HUa0	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

Human Elongation factor 1-alpha 1 (EEF1A1)
1-CSB-EP007409HUe1	Cusabio	EUR 496.00 EUR 330.00 EUR 1425.00 EUR 677.00 EUR 989.00 EUR 378.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-alpha 1(EEF1A1) expressed in E.coli

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0654802	ABM	1.0 ug DNA	EUR 154.00

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0654803	ABM	1.0 ug DNA	EUR 154.00

EEF1A1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0654804	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3976802	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3976803	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3976804	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7550702	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7550703	ABM	1.0 ug DNA	EUR 154.00

Eef1a1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7550704	ABM	1.0 ug DNA	EUR 154.00

EEF1A1 Protein Vector (Rat) (pPB-C-His)
PV265442	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Rat) (pPB-N-His)
PV265443	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Rat) (pPM-C-HA)
PV265444	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Rat) (pPM-C-His)
PV265445	ABM	500 ng	EUR 603.00

EEF1A1 3'UTR Luciferase Stable Cell Line
TU006573	ABM	1.0 ml	EUR 1521.00

EEF1A1 3'UTR GFP Stable Cell Line
TU056573	ABM	1.0 ml	EUR 1521.00

EEF1A1 Protein Vector (Mouse) (pPB-C-His)
PV174530	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPB-N-His)
PV174531	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPM-C-HA)
PV174532	ABM	500 ng	EUR 603.00

EEF1A1 Protein Vector (Mouse) (pPM-C-His)
PV174533	ABM	500 ng	EUR 603.00

Eef1a1 3'UTR GFP Stable Cell Line
TU155609	ABM	1.0 ml	Ask for price

Eef1a1 3'UTR GFP Stable Cell Line
TU253787	ABM	1.0 ml	Ask for price

Eef1a1 3'UTR Luciferase Stable Cell Line
TU203787	ABM	1.0 ml	Ask for price

Eef1a1 3'UTR Luciferase Stable Cell Line
TU105609	ABM	1.0 ml	Ask for price

EEF1A1 Protein Vector (Human) (pPB-C-His)
PV013589	ABM	500 ng	EUR 329.00

EEF1A1 Protein Vector (Human) (pPB-N-His)
PV013590	ABM	500 ng	EUR 329.00

EEF1A1 Protein Vector (Human) (pPM-C-HA)
PV013591	ABM	500 ng	EUR 329.00

EEF1A1 Protein Vector (Human) (pPM-C-His)
PV013592	ABM	500 ng	EUR 329.00

EEF1A1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV673339	ABM	1.0 ug DNA	EUR 682.00

EEF1A1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV673343	ABM	1.0 ug DNA	EUR 682.00

EEF1A1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV673344	ABM	1.0 ug DNA	EUR 682.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx232641-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx032889-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx032889-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx032890-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx032890-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx312697	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx000927	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Bovine Elongation factor 1- alpha 1, EEF1A1 ELISA KIT
ELI-47134b	Lifescience Market	96 Tests	EUR 928.00

Mouse Elongation factor 1- alpha 1, Eef1a1 ELISA KIT
ELI-09608m	Lifescience Market	96 Tests	EUR 865.00

Human Elongation factor 1- alpha 1, EEF1A1 ELISA KIT
ELI-08681h	Lifescience Market	96 Tests	EUR 824.00

Rabbit Elongation factor 1- alpha 1, EEF1A1 ELISA KIT
ELI-08682Ra	Lifescience Market	96 Tests	EUR 928.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody
20-abx172297	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit
abx250573-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx327486	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cow Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit
abx515460-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit
abx515462-96tests	Abbexa	96 tests	EUR 739.00
Shipped within 5-12 working days.

Rat Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit
abx515463-96tests	Abbexa	96 tests	EUR 739.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx126891	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
abx145202-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx141573	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Antibody
20-abx130797	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody
20-abx112349	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human Elongation Factor 1 Alpha 1 (EEF1A1) ELISA Kit
20-abx156817	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Recombinant Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1)
4-RPF020Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P68104 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Alpha 1 expressed in: E.coli

Rat Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit
E0318Ra	Sunlong	1 Kit	EUR 646.00

Human EEF1A1/ Elongation factor 1-alpha 1 ELISA Kit
E0762Hu	Sunlong	1 Kit	EUR 605.00

Mouse Eef1a1/ Elongation factor 1-alpha 1 ELISA Kit
E0449Mo	Sunlong	1 Kit	EUR 632.00

Human EEF1A1(Elongation factor 1-alpha 1) ELISA Kit
EH1308	FN Test	96T	EUR 567.60
Detection range: 0.156-10 ng/ml Uniprot ID: P68104 Alias: EEF1A1(Elongation factor 1-alpha 1)/EEF1A/EF1A/LENG7/EF-1-alpha-1/EF-Tu/eEF1A-1/Leukocyte receptor cluster member 7/Elongation factor Tu/Eukaryotic elongation factor 1 A-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human EEF1A1 AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)
35679-05181	AssayPro	1 x 75 ug, 3 x 30 ug	EUR 585.00

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (HRP)
20-abx312698	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (FITC)
20-abx312699	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) Antibody (Biotin)
20-abx312700	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1a1) Protein
20-abx650631	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0654805	ABM	3 x 1.0 ug	EUR 376.00

Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3976805	ABM	3 x 1.0 ug	EUR 376.00

Eef1a1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7550705	ABM	3 x 1.0 ug	EUR 376.00

EEF1A1 ELISA Kit| Bovine Elongation factor 1-alpha 1 ELISA Kit
EF011364	Lifescience Market	96 Tests	EUR 689.00

Eef1a1 ELISA Kit| Rat Elongation factor 1-alpha 1 ELISA Kit
EF018653	Lifescience Market	96 Tests	EUR 689.00

Eef1a1 ELISA Kit| Mouse Elongation factor 1-alpha 1 ELISA Kit
EF014837	Lifescience Market	96 Tests	EUR 689.00

Human Eukaryotic Translation Elongation Factor 1 Alpha 1 (EEF1A1) CLIA Kit
20-abx494790	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0654806	ABM	1.0 ug DNA	EUR 167.00

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0654807	ABM	1.0 ug DNA	EUR 167.00

EEF1A1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0654808	ABM	1.0 ug DNA	EUR 167.00

Aiming to higher perceive essentially the most essential genetic modifications in Babesia bovis genome, associated to virulence, an in silico evaluation was carried out utilizing DNA sequences from GenBank. Fourteen genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80 (or Bb-1), 18S rRNA, acs-1, ama-1, β-tub, cp-2, p0, rap-1a) associated to parasite an infection and immunogenicity and ITS area have been chosen for alignment and comparability of a number of isolates of Babesia bovis from completely different geographic areas all over the world.

Among the 15 genes chosen for the examine of variety, solely 7 genes (sbp-2, sbp-4, lure, msa-1, msa-2b, msa-2c, Bv80) and the ITS area introduced ample genetic variation for the research of phylogeny. Despite this genetic variety noticed into teams, there was not ample info obtainable to affiliate molecular markers with virulence of isolates. However, some genetic teams no have been correlated with geographic area what might point out some typical evolutionary traits within the relation between parasite-host.

Further research utilizing these genes in herds presenting numerous scientific circumstances are required. The higher understanding of evolutionary mechanisms of the parasite might contribute to enhance prophylactic and therapeutic measures. In this fashion, we recommend that genes utilized in our examine are potential markers of virulence and attenuation and need to be analyzed with using sequences from animals that current scientific indicators of babesiosis and asymptomatic carriers.